pcDNA3.1_SM-FLuc100-malat1
(Plasmid
#210581)
-
PurposeExpresses SM(FLAG)-optimal Firefly luciferase - 3'UTR malat1 triple helix
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210581 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Total vector size (bp) 8037
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpaghetti monster (FLAG)-optimal FLuc - 3'UTR malat1 triple helix
-
Alt nameFirefly
-
Alt nameFLuc
-
Insert Size (bp)2661
- Promoter CMV
-
Tag
/ Fusion Protein
- Spaghetti monster (FLAG) (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV_F
- 3′ sequencing primer cctaaagggagcccccgatttag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1_SM-FLuc100-malat1 was a gift from Olivia Rissland (Addgene plasmid # 210581 ; http://n2t.net/addgene:210581 ; RRID:Addgene_210581) -
For your References section:
Synonymous codon usage regulates translation initiation. Barrington CL, Galindo G, Koch AL, Horton ER, Morrison EJ, Tisa S, Stasevich TJ, Rissland OS. Cell Rep. 2023 Dec 26;42(12):113413. doi: 10.1016/j.celrep.2023.113413. Epub 2023 Dec 12. 10.1016/j.celrep.2023.113413 PubMed 38096059