pSLQ11274:pHR-hU6-crTet-HSP-hyperdCas12a-miniVPR-CMV-mCherry
(Plasmid
#210603)
-
Purposeheat shock promoter - activated hyperdCas12a-based transcriptional activator
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210603 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHR
- Backbone size w/o insert (bp) 5842
- Total vector size (bp) 13578
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehyperdCas12a-miniVPR
-
Insert Size (bp)7736
- Promoter truncated hsp70
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AATTCTACCACTGAACCACC
- 3′ sequencing primer gtgcttcacgctggtctgggcgtac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ11274:pHR-hU6-crTet-HSP-hyperdCas12a-miniVPR-CMV-mCherry was a gift from Stanley Qi (Addgene plasmid # 210603 ; http://n2t.net/addgene:210603 ; RRID:Addgene_210603) -
For your References section:
Sonogenetic control of multiplexed genome regulation and base editing. Liu P, Foiret J, Situ Y, Zhang N, Kare AJ, Wu B, Raie MN, Ferrara KW, Qi LS. Nat Commun. 2023 Oct 18;14(1):6575. doi: 10.1038/s41467-023-42249-8. 10.1038/s41467-023-42249-8 PubMed 37852951