pSLQ5135: pCAG-BFP-GuideArray
(Plasmid
#210606)
-
PurposeGuide array for hyperdCas12a-based transcriptional activator with AAAT synSeparator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210606 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2727
- Total vector size (bp) 5435
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepCAG-BFP-GuideArray
-
Alt namefive guides targeting four genes: IL18, IL7, IFNg, and IL2
-
Insert Size (bp)2708
- Promoter CAG
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gtaaaacgacggccagt
- 3′ sequencing primer gatgagtttggacaaaccac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ5135: pCAG-BFP-GuideArray was a gift from Stanley Qi (Addgene plasmid # 210606 ; http://n2t.net/addgene:210606 ; RRID:Addgene_210606) -
For your References section:
Sonogenetic control of multiplexed genome regulation and base editing. Liu P, Foiret J, Situ Y, Zhang N, Kare AJ, Wu B, Raie MN, Ferrara KW, Qi LS. Nat Commun. 2023 Oct 18;14(1):6575. doi: 10.1038/s41467-023-42249-8. 10.1038/s41467-023-42249-8 PubMed 37852951