AAV-U6-Agrp-(mouse)-MS2gRNA-hSyn-MCP-MSN
(Plasmid
#210709)
-
PurposeThis Plasmid express U6 promoter driven SpdCas9 specific gRNA and hSyn promoter driven MCP-MSN transactivation module
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210709 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSpdCas9 specific Agrp (mouse) MS2gRNA and MCP-MSN
-
SpeciesH. sapiens (human), Synthetic; Streptococcus pyogenes
-
Insert Size (bp)2260
-
MutationN55K in MCP
-
GenBank IDNM_001282660.2 NM_001384880.1
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Stbl3 is also a suitable growth strain.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-U6-Agrp-(mouse)-MS2gRNA-hSyn-MCP-MSN was a gift from Isaac Hilton (Addgene plasmid # 210709 ; http://n2t.net/addgene:210709 ; RRID:Addgene_210709) -
For your References section:
Compact engineered human mechanosensitive transactivation modules enable potent and versatile synthetic transcriptional control. Mahata B, Cabrera A, Brenner DA, Guerra-Resendez RS, Li J, Goell J, Wang K, Guo Y, Escobar M, Parthasarathy AK, Szadowski H, Bedford G, Reed DR, Kim S, Hilton IB. Nat Methods. 2023 Oct 9. doi: 10.1038/s41592-023-02036-1. 10.1038/s41592-023-02036-1 PubMed 37813990