-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21100 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePBS/U6
- Backbone size w/o insert (bp) 3300
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRNAi against histone deacetylase4
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)70
-
Entrez GeneHDAC4 (a.k.a. AHO3, BDMR, HA6116, HD4, HDAC-4, HDAC-A, HDACA, NEDCHF, NEDCHID)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site APAI (not destroyed)
- 3′ cloning site ECORI (not destroyed)
- 5′ sequencing primer T7 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
HDAC4 RNAi target sequence
GGAGATGCTGGCCATGAAGCA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pbs/pU6-HDAC4 RNAi was a gift from Connie Cepko (Addgene plasmid # 21100 ; http://n2t.net/addgene:21100 ; RRID:Addgene_21100) -
For your References section:
HDAC4 regulates neuronal survival in normal and diseased retinas. Chen B, Cepko CL. Science. 2009 Jan 9. 323(5911):256-9. 10.1126/science.1166226 PubMed 19131628