Skip to main content
Addgene

pEGFP-N1/mCherry-DMDEx23
(Plasmid #211367)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211367 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4686
  • Total vector size (bp) 5970
  • Vector type
    Mammalian Expression
  • Selectable markers
    eGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry-DMDEx23
  • Species
    Discosoma sp.
  • Insert Size (bp)
    1284
  • Mutation
    mCherry interrupted by mdx dystrophin exon 23 between nucleotide 105 and 106 flanked by intronic sequences. Donor splice site downstream of mdx exon 23 is based on the physiological donor splice site sequence of murine DMD intron 23.
  • Promoter CMV
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TGGGAGGTCTATATAAGCAGAG
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-N1/mCherry-DMDEx23 was a gift from Ulrich Lächelt (Addgene plasmid # 211367 ; http://n2t.net/addgene:211367 ; RRID:Addgene_211367)
  • For your References section:

    mCherry on Top: A Positive Read-Out Cellular Platform for Screening DMD Exon Skipping Xenopeptide-PMO Conjugates. Lessl AL, Pohmerer J, Lin Y, Wilk U, Hohn M, Horterer E, Wagner E, Lachelt U. Bioconjug Chem. 2023 Dec 20;34(12):2263-2274. doi: 10.1021/acs.bioconjchem.3c00408. Epub 2023 Nov 22. 10.1021/acs.bioconjchem.3c00408 PubMed 37991502