pEGFP-N1/mCherry-DMDEx23
(Plasmid #211367)

• Purpose: Expresses a DMD exon 23 skipping reporter in mammalian cells (mCherry-DMDEx23)
• Depositing Lab: Ulrich Lächelt
• Publication: Lessl et al Bioconjug Chem. 2023 Dec 20;34(12):2263-2274. doi: 10.1021/acs.bioconjchem.3c00408. Epub 2023 Nov 22.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4686
• Total vector size (bp): 5970
• Vector type: Mammalian Expression
• Selectable markers: eGFP

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry-DMDEx23
• Species: Discosoma sp.
• Insert Size (bp): 1284
• Mutation: mCherry interrupted by mdx dystrophin exon 23 between nucleotide 105 and 106 flanked by intronic sequences. Donor splice site downstream of mdx exon 23 is based on the physiological donor splice site sequence of murine DMD intron 23.
• Promoter: CMV
• Tag / Fusion Protein:
  • eGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TGGGAGGTCTATATAAGCAGAG
• 3′ sequencing primer: CGTCGCCGTCCAGCTCGACCAG

Resource Information

• Supplemental Documents:
  • pEGFP-N1_mCherry-DMDex23.gb
• A portion of this plasmid was derived from a plasmid made by: BioCat GmbH

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry