pLenti-GFP-2A-Puro-gHUS1_B
(Plasmid
#211542)
-
PurposesgRNA-B against HUS1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211542 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti
- Backbone size w/o insert (bp) 9544
- Total vector size (bp) 9564
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA HUS1
-
gRNA/shRNA sequenceGACCCATGACATCCCCATAA
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gactatcatatgcttaccgt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-GFP-2A-Puro-gHUS1_B was a gift from Agnel Sfeir (Addgene plasmid # 211542 ; http://n2t.net/addgene:211542 ; RRID:Addgene_211542) -
For your References section:
RHINO directs MMEJ to repair DNA breaks in mitosis. Brambati A, Sacco O, Porcella S, Heyza J, Kareh M, Schmidt JC, Sfeir A. Science. 2023 Aug 11;381(6658):653-660. doi: 10.1126/science.adh3694. Epub 2023 Jul 13. 10.1126/science.adh3694 PubMed 37440612