pCF821-sgCIDE-22_U6-sgRNA-EF1a-mNeonGreen
(Plasmid
#211672)
-
PurposeU6-sgRNA-EF1a-mNeonGreen
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211672 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCF821
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpyCas9 and sgCIDE-22 guide RNA vector
-
gRNA/shRNA sequenceTTGTTCCACCTATAGGGTTG
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCF821-sgCIDE-22_U6-sgRNA-EF1a-mNeonGreen was a gift from Christof Fellmann (Addgene plasmid # 211672 ; http://n2t.net/addgene:211672 ; RRID:Addgene_211672) -
For your References section:
Targeting the non-coding genome and temozolomide signature enables CRISPR-mediated glioma oncolysis. Tan IL, Perez AR, Lew RJ, Sun X, Baldwin A, Zhu YK, Shah MM, Berger MS, Doudna JA, Fellmann C. Cell Rep. 2023 Nov 28;42(11):113339. doi: 10.1016/j.celrep.2023.113339. Epub 2023 Nov 2. 10.1016/j.celrep.2023.113339 PubMed 37917583