pEJS-HZ03-pLenti-U1a-mSpCas9-U6-tracrRNA-PuroR
(Plasmid
#211815)
-
Purposelentiviral vector expressing SpCas9 and tracrRNA for stable cell line establishment
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211815 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelentiviral backbone
- Backbone size w/o insert (bp) 5313
- Total vector size (bp) 11610
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpCas9, tracrRNA and puromycin selection gene
-
SpeciesSynthetic
-
Insert Size (bp)6297
- Promoter U1a promoter, U6 promoter, and hPGK promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCAACCCCGAGGGatggaggcggtac
- 3′ sequencing primer TGGGGCGGGCGTCAGGCACCGGGCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.03.20.533459 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEJS-HZ03-pLenti-U1a-mSpCas9-U6-tracrRNA-PuroR was a gift from Erik Sontheimer (Addgene plasmid # 211815 ; http://n2t.net/addgene:211815 ; RRID:Addgene_211815) -
For your References section:
Self-delivering, chemically modified CRISPR RNAs for AAV co-delivery and genome editing in vivo. Zhang H, Kelly K, Lee J, Echeverria D, Cooper D, Panwala R, Amrani N, Chen Z, Gaston N, Wagh A, Newby GA, Xie J, Liu DR, Gao G, Wolfe SA, Khvorova A, Watts JK, Sontheimer EJ. Nucleic Acids Res. 2023 Nov 30:gkad1125. doi: 10.1093/nar/gkad1125. 10.1093/nar/gkad1125 PubMed 38033325