Skip to main content
Addgene

pFUW-VenusFlag-hCD44
(Plasmid #211824)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211824 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFUW
  • Backbone manufacturer
    10000
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD44
  • Alt name
    MIC4, MDU2, MDU3
  • Species
    H. sapiens (human)
  • Mutation
    isoform corresponds to UniProt ID P16070-1 with amino acid changes K374R and I436T consistent with ORFeome V8.1 source (doi: 10.1038/nmeth.1638)
  • GenBank ID
    NM_001001389.2
  • Entrez Gene
    CD44 (a.k.a. CDW44, CSPG8, ECM-III, ECMR-III, H-CAM, HCELL, HUTCH-1, HUTCH-I, Hermes-1, IN, LHR, MC56, MDU2, MDU3, MIC4, Pgp1)
  • Tag / Fusion Protein
    • N-Terminal Venus and Flag tags

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TGAAGCTCCGGTTTTGAACT
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    hORFeome V8.1 (doi: 10.1038/nmeth.1638), RNA interference (RNAi) Platform, Broad Institute of Harvard and Massachusetts Institute of Technology, Cambridge, Massachusetts, USA

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is also included in the TREAT-AD Plasmid Collection (https://www.addgene.org/depositor-collections/treat-ad/)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUW-VenusFlag-hCD44 was a gift from Haian Fu (Addgene plasmid # 211824 ; http://n2t.net/addgene:211824 ; RRID:Addgene_211824)
  • For your References section:

    Discovery of FERM domain protein-protein interaction inhibitors for MSN and CD44 as a potential therapeutic approach for Alzheimer's disease. Du Y, Bradshaw WJ, Leisner TM, Annor-Gyamfi JK, Qian K, Bashore FM, Sikdar A, Nwogbo FO, Ivanov AA, Frye SV, Gileadi O, Brennan PE, Levey AI, Axtman AD, Pearce KH, Fu H, Katis VL. J Biol Chem. 2023 Oct 20:105382. doi: 10.1016/j.jbc.2023.105382. 10.1016/j.jbc.2023.105382 PubMed 37866628