Skip to main content

pALS3-Ma-sfGFP-TAG150
(Plasmid #212121)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 212121 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pALS3
  • Backbone size w/o insert (bp) 4807
  • Total vector size (bp) 5551
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    sfGFP-150TAG
  • Insert Size (bp)
    744
  • Mutation
    N150TAG
  • Promoter araC
  • Tag / Fusion Protein
    • His6 (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NocI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    M. alvus Pyl-tRNA(6)
  • Species
    Methanomethylophilus alvus
  • Insert Size (bp)
    75
  • Promoter lpp

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid encodes expression of a) sfGFP with an amber (TAG) codon at N150 and b) Methanomethylophilus alvus tRNA(6). It is to be paired with a plasmid that expresses an M. alvus pyrrolysyl-tRNA synthetase (MaRS). The pALS3 plasmid is used during fluorescence-based selection and characterization of MaRS mutants. It is distinguished from a previous Ma version by containing a tetracycline efflux marker.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pALS3-Ma-sfGFP-TAG150 was a gift from Ryan Mehl (Addgene plasmid # 212121 ; http://n2t.net/addgene:212121 ; RRID:Addgene_212121)