pALS3-Ma-sfGFP-TAG150
(Plasmid
#212121)
-
PurposeFluorescence plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses sfGFP-TAG150 and M. alvus Pyl-tRNA(6). p15a origin. Tetracycline resistance.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212121 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepALS3
- Backbone size w/o insert (bp) 4807
- Total vector size (bp) 5551
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namesfGFP-150TAG
-
Insert Size (bp)744
-
MutationN150TAG
- Promoter araC
-
Tag
/ Fusion Protein
- His6 (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NocI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameM. alvus Pyl-tRNA(6)
-
SpeciesMethanomethylophilus alvus
-
Insert Size (bp)75
- Promoter lpp
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer TTCTGTTGCCCGTCTCACTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid encodes expression of a) sfGFP with an amber (TAG) codon at N150 and b) Methanomethylophilus alvus tRNA(6). It is to be paired with a plasmid that expresses an M. alvus pyrrolysyl-tRNA synthetase (MaRS). The pALS3 plasmid is used during fluorescence-based selection and characterization of MaRS mutants. It is distinguished from a previous Ma version by containing a tetracycline efflux marker.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pALS3-Ma-sfGFP-TAG150 was a gift from Ryan Mehl (Addgene plasmid # 212121 ; http://n2t.net/addgene:212121 ; RRID:Addgene_212121)