pET29-bdSUMO-Anti-ALFA nanobody
(Plasmid
#212311)
-
PurposeExpression of anti-ALFA nanobody
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212311 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET29
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameanti-ALFA nanobody
-
SpeciesVicugna pacos
- Promoter T7
-
Tag
/ Fusion Protein
- bdSUMO (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CTAGTTATTGCTCAGCGGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET29-bdSUMO-Anti-ALFA nanobody was a gift from Arthur Laganowsky (Addgene plasmid # 212311 ; http://n2t.net/addgene:212311 ; RRID:Addgene_212311) -
For your References section:
Grafting the ALFA tag for structural studies of aquaporin Z. Stover L, Bahramimoghaddam H, Wang L, Schrecke S, Yadav GP, Zhou M, Laganowsky A. J Struct Biol X. 2024 Feb 2;9:100097. doi: 10.1016/j.yjsbx.2024.100097. eCollection 2024 Jun. 10.1016/j.yjsbx.2024.100097 PubMed 38361954