pTarget_dnaA-mEos4b
(Plasmid
#212607)
-
PurposeContains the E. coli codon-optimised gene of the photoactivatable fluorescent protein mEos4b, together with a sgRNA for SpydCas9 targeting the E. coli dnaA gene.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212607 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMB1
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemEos4b
-
Alt namednaA gRNA
-
gRNA/shRNA sequenceCGTCGCGGCCCCTGCACAGG
-
SpeciesSynthetic; Escherichia coli
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTarget_dnaA-mEos4b was a gift from John van der Oost (Addgene plasmid # 212607 ; http://n2t.net/addgene:212607 ; RRID:Addgene_212607) -
For your References section:
The Escherichia coli replication initiator DnaA is titrated on the chromosome. Olivi L, Kostlbacher S, Ludwig C, Langendoen M, Claassens NJ, Ettema TJG, van der Oost J, Ten Wolde PR, Hohlbein J, Staals RHJ. Nat Commun. 2025 Aug 21;16(1):7813. doi: 10.1038/s41467-025-63147-1. 10.1038/s41467-025-63147-1 PubMed 40841366