pLV_EF1a_Gag
(Plasmid
#212638)
-
PurposeLentivirus vector to express MLV Gag
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212638 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersZeocin ; mNeon
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMLV Gag (UniProt ID: P03332)
-
SpeciesMoMLV
-
Entrez Genegag (a.k.a. MLVgp8)
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcgatggagtttccccacactg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe MLV Gag ORF was cloned from MLV Gag-YFP (Addgene Plasmid #1813, a gift from Walther Mothes)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV_EF1a_Gag was a gift from Paul Blainey (Addgene plasmid # 212638 ; http://n2t.net/addgene:212638 ; RRID:Addgene_212638) -
For your References section:
Live-cell transcriptomics with engineered virus-like particles. Najia MA, Borrajo J, Le A, Tsai F, Huang JY, Griffith LG, Daley GQ, Blainey PC. bioRxiv 2024.10.01.616098 10.1101/2024.10.01.616098