-
PurposeA SCHEMA evolved AAV variant effective at targeting subventricular NSCs
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212708 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSub2Cap
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 8800
-
Modifications to backboneRemoval of AAV ITR
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAV2 Rep SCH9 Cap
-
SpeciesAAV
-
Insert Size (bp)4800
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer GGTACGAAGCTTCGATCAACTACGCAG
- 3′ sequencing primer AGCTAGCCTATTTACCGATAC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV SCH9 was a gift from David Schaffer (Addgene plasmid # 212708 ; http://n2t.net/addgene:212708 ; RRID:Addgene_212708) -
For your References section:
In Vivo Selection of a Computationally Designed SCHEMA AAV Library Yields a Novel Variant for Infection of Adult Neural Stem Cells in the SVZ. Ojala DS, Sun S, Santiago-Ortiz JL, Shapiro MG, Romero PA, Schaffer DV. Mol Ther. 2018 Jan 3;26(1):304-319. doi: 10.1016/j.ymthe.2017.09.006. Epub 2017 Sep 8. 10.1016/j.ymthe.2017.09.006 PubMed 28988711