Skip to main content

TALED_ Left-mouse-mtRnr1_A1555G-8e-E1347A
(Plasmid #212949)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 212949 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV
  • Total vector size (bp) 7248
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TALED_ Left-mouse-mtRnr1_A1555G-8e-E1347A
  • Species
    Synthetic
  • Insert Size (bp)
    3522
  • Entrez Gene
    mt-Rnr1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TALED_ Left-mouse-mtRnr1_A1555G-8e-E1347A was a gift from Jin-Soo Kim (Addgene plasmid # 212949 ; http://n2t.net/addgene:212949 ; RRID:Addgene_212949)
  • For your References section:

    Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNA. Cho SI, Lim K, Hong S, Lee J, Kim A, Lim CJ, Ryou S, Lee JM, Mok YG, Chung E, Kim S, Han S, Cho SM, Kim J, Kim EK, Nam KH, Oh Y, Choi M, An TH, Oh KJ, Lee S, Lee H, Kim JS. Cell. 2024 Jan 4;187(1):95-109.e26. doi: 10.1016/j.cell.2023.11.035. 10.1016/j.cell.2023.11.035 PubMed 38181745