TALED_Right-mouse-ATP6-1397C-AD(V28R)
(Plasmid
#212955)
-
PurposeExpresses TALED_Right-mouse-ATP6-1397C-AD(V28R) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212955 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV
- Total vector size (bp) 6966
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRight-mouse-ATP6-1397C-AD(V28R)
-
SpeciesSynthetic
-
Insert Size (bp)3240
-
Entrez GeneATP6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TALED_Right-mouse-ATP6-1397C-AD(V28R) was a gift from Jin-Soo Kim (Addgene plasmid # 212955 ; http://n2t.net/addgene:212955 ; RRID:Addgene_212955) -
For your References section:
Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNA. Cho SI, Lim K, Hong S, Lee J, Kim A, Lim CJ, Ryou S, Lee JM, Mok YG, Chung E, Kim S, Han S, Cho SM, Kim J, Kim EK, Nam KH, Oh Y, Choi M, An TH, Oh KJ, Lee S, Lee H, Kim JS. Cell. 2024 Jan 4;187(1):95-109.e26. doi: 10.1016/j.cell.2023.11.035. 10.1016/j.cell.2023.11.035 PubMed 38181745