pαH-S-GSAS/XBB.1.5
(Plasmid
#212991)
-
Purpose"Mammalian cell expression of SARS-CoV-2 Spike protein of Omicron.XBB.1.5 variant
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212991 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepαH
- Backbone size w/o insert (bp) 4746
- Total vector size (bp) 8358
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepαH-S-GSAS/XBB.1.5
-
Alt nameSARS-CoV 2-Omicron.XBB.1.5
-
Insert Size (bp)3612
-
Mutation(T19I,Del24/26,A27S,V83A,G142D,Del144,H146Q,Q183E,V213E,G252V, G339H,R346T,L368I,S371F,S373P,S375F,T376A,D405N,R408S,K417N,N440K,V445P,G446S,N460K,S477N,T478K,E484A,F486P,F490S,Q498R,N501Y,Y505H,H655Y,N679K,P681H,N764K,D796Y,Q954H,N969K)
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter CMV
-
Tag
/ Fusion Protein
- HRV 3C cleavage site (before tags) C terminal on backbone 8X His tag C and 2X Strep-Tag II C terminal on backbone (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cctctgctaaccatgttcatgc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A portion of this plasmid was derived from a plasmid made by Jason McLellan;
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pαH-S-GSAS/XBB.1.5 was a gift from Priyamvada Acharya (Addgene plasmid # 212991 ; http://n2t.net/addgene:212991 ; RRID:Addgene_212991) -
For your References section:
SARS-CoV-2 Omicron XBB lineage spike structures, conformations, antigenicity, and receptor recognition. Zhang QE, Lindenberger J, Parsons R, Thakur B, Parks R, Park CS, Huang X, Sammour S, Janowska K, Spence TN, Edwards RJ, Martin M, Williams WB, Gobeil S, Montefiori DC, Korber B, Saunders KO, Haynes BF, Haynes BF, Henderson R, Acharya P. bioRxiv [Preprint]. 2024 Mar 12:2024.02.12.580004. doi: 10.1101/2024.02.12.580004. 10.1101/2024.02.12.580004 PubMed 38405707