pMT692 ORF2p-3C-3xF (1-1275, ORFeus-Hs) in pDARMO-PolH2.1
(Plasmid
#213025)
-
PurposeExpresses full length human LINE-1 ORF2p Core (1-1275) with a C-terminal 3xFlag tag for baculovirus production in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213025 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDARMO-PolH2.1
-
Backbone manufacturerKacper Rogala, modified by Martin Taylor
- Backbone size w/o insert (bp) 3541
- Total vector size (bp) 7481
-
Modifications to backboneAddition of Golden Gate acceptor sites (00-02) for directional assembly of MultiBac type plasmids.
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrow at 30C in NEBStable if additional inserts are included in a MultiBac
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLINE-1 ORF2p (1-1275)
-
Alt nameORF2p
-
Alt nameORF2
-
Alt nameLORF2_HUMAN
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3940
-
GenBank IDAAC51271.1
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- 3C-3xFlag (ORF2p) (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer Polyhedrin-Forward (GGAGATAATTAAAATGATAACCATCTCGC)
- 3′ sequencing primer Polyhedrin-pA-Rev (TCGAACCTTTATTACAAAACAAAACACA)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Includes polyhedrin terminator and backbone is designed to be useful in MultiBac scenarios. Note that relative to some insect vectors, the Tn7 sites are reversed, so the insert may be flipped in the destination bacmid and PCR primers may need to be swapped accordingly.
The construct is based on the synthetic L1 ORFeus-Hs sequence generated in the lab of Jef Boeke (see W. An et al., Mobile DNA 2, 2011 https://doi.org/10.1186/1759-8753-2-2)
For more on pDARMO vectors see Rogala, K. B. et al. Structural basis for the docking of mTORC1 on the lysosomal surface. Science 366, 468-475 (2019). https://doi.org/10.1126/science.aay0166
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMT692 ORF2p-3C-3xF (1-1275, ORFeus-Hs) in pDARMO-PolH2.1 was a gift from Martin S. Taylor (Addgene plasmid # 213025 ; http://n2t.net/addgene:213025 ; RRID:Addgene_213025) -
For your References section:
Structures, functions and adaptations of the human LINE-1 ORF2 protein. Baldwin ET, van Eeuwen T, Hoyos D, Zalevsky A, Tchesnokov EP, Sanchez R, Miller BD, Di Stefano LH, Ruiz FX, Hancock M, Isik E, Mendez-Dorantes C, Walpole T, Nichols C, Wan P, Riento K, Halls-Kass R, Augustin M, Lammens A, Jestel A, Upla P, Xibinaku K, Congreve S, Hennink M, Rogala KB, Schneider AM, Fairman JE, Christensen SM, Desrosiers B, Bisacchi GS, Saunders OL, Hafeez N, Miao W, Kapeller R, Zaller DM, Sali A, Weichenrieder O, Burns KH, Gotte M, Rout MP, Arnold E, Greenbaum BD, Romero DL, LaCava J, Taylor MS. Nature. 2024 Feb;626(7997):194-206. doi: 10.1038/s41586-023-06947-z. Epub 2023 Dec 14. 10.1038/s41586-023-06947-z PubMed 38096902