Skip to main content

pLX-PVX
(Plasmid #213040)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213040 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLX-B2
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Potato virus X
  • Alt name
    PVX
  • GenBank ID
    MT799816.1
  • Promoter Cauliflower mosaic virus 35S

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAAAACTAAACCATACACCACCAAC
  • 3′ sequencing primer ATTTATATTATTCATACAATCAAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX-PVX was a gift from Jose-Antonio Daros (Addgene plasmid # 213040 ; http://n2t.net/addgene:213040 ; RRID:Addgene_213040)
  • For your References section:

    RNA virus-mediated gene editing for tomato trait breeding. Uranga M, Aragones V, Garcia A, Mirabel S, Gianoglio S, Presa S, Granell A, Pasin F, Daros JA. Hortic Res. 2023 Dec 19;11(1):uhad279. doi: 10.1093/hr/uhad279. eCollection 2024 Jan. 10.1093/hr/uhad279 PubMed 38895601