Skip to main content

pLV-EF1a-MinE-EGFP_IRES-Blast
(Plasmid #213113)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213113 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLV-EF1a
  • Backbone size w/o insert (bp) 8528
  • Total vector size (bp) 9545
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MinE-EGFP
  • Species
    Escherichia coli
  • Insert Size (bp)
    1017
  • Entrez Gene
    minE (a.k.a. b1174, ECK1162, minB)
  • Promoter EF1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer EF1a_F (TCAAGCCTCAGACAGTGGTTC)
  • 3′ sequencing primer EF1a_R (TAGAGGGAAACCGTTGCTAGC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-EF1a-MinE-EGFP_IRES-Blast was a gift from Scott Coyle (Addgene plasmid # 213113)
  • For your References section:

    A programmable reaction-diffusion system for spatiotemporal cell signaling circuit design. Rajasekaran R, Chang CC, Weix EWZ, Galateo TM, Coyle SM. Cell. 2023 Dec 27:S0092-8674(23)01339-9. doi: 10.1016/j.cell.2023.12.007. 10.1016/j.cell.2023.12.007 PubMed 38181787