Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLentiPGK Puro DEST JNKKTRmCerulean3
(Plasmid #90232)


Item Catalog # Description Quantity Price (USD)
Plasmid 90232 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pLENTI PGK Puro DEST (w529-2)
  • Backbone manufacturer
    Eric Campeau Lab (Addgene Plasmid 19068)
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin (50 ug/mL)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    JNK Kinase Translocation Reporter
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Promoter PGK
  • Tag / Fusion Protein
    • mCerulean3 (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ACCGAATCACCGACCTCTCT
  • 3′ sequencing primer GCAGCGTATCCACATAGCG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiPGK Puro DEST JNKKTRmCerulean3 was a gift from Markus Covert (Addgene plasmid # 90232)
  • For your References section:

    Live-cell measurements of kinase activity in single cells using translocation reporters. Kudo T, Jeknic S, Macklin DN, Akhter S, Hughey JJ, Regot S, Covert MW. Nat Protoc. 2018 Jan;13(1):155-169. doi: 10.1038/nprot.2017.128. Epub 2017 Dec 21. 10.1038/nprot.2017.128 PubMed 29266096