Skip to main content

CIRTS-Gas5
(Plasmid #213172)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213172 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFsy(1.1)GW
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 9801
  • Total vector size (bp) 12593
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CIRTS-Calm3-U6-Gas5 gRNA
  • Species
    Synthetic
  • Insert Size (bp)
    3531
  • Promoter Syn1, U6
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer Syn1 Forward CCACAAGAGGTGCAAGATAGG
  • 3′ sequencing primer WPRE-R CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The original CIRTS PIN nuclease is obtained from Bryan Dickinson Lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CIRTS-Gas5 was a gift from Timothy Bredy (Addgene plasmid # 213172 ; http://n2t.net/addgene:213172 ; RRID:Addgene_213172)
  • For your References section:

    Fear extinction is regulated by the activity of long noncoding RNAs at the synapse. Liau WS, Zhao Q, Bademosi A, Gormal RS, Gong H, Marshall PR, Periyakaruppiah A, Madugalle SU, Zajaczkowski EL, Leighton LJ, Ren H, Musgrove M, Davies J, Rauch S, He C, Dickinson BC, Li X, Wei W, Meunier FA, Fernandez-Moya SM, Kiebler MA, Srinivasan B, Banerjee S, Clark M, Spitale RC, Bredy TW. Nat Commun. 2023 Nov 22;14(1):7616. doi: 10.1038/s41467-023-43535-1. 10.1038/s41467-023-43535-1 PubMed 37993455