-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21338 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLKO.1
-
Backbone manufacturerAvailable from Addgene
- Backbone size w/o insert (bp) 7032
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Growth instructionsXL10 Gold Ultracompetent Cells from Stratagene or nStb13. Grow in SOC media at 37oC
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDEPTOR shRNA 2
-
Alt nameDEPTOR
-
Alt nameDEPDC6
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)60
-
GenBank IDNM_145470
-
Entrez GeneDeptor (a.k.a. 4731402B04Rik, 9130412E02Rik, D15Ertd336e, D15Ertd597e, Depdc6, Depdc6-001, Depdc6-002, R75183, mKIAA4200)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
Reference
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
mouse DEPTOR shRNA 2
TRCN0000110159; NM_145470.1-1165s1c1
shRNA oligo sequence is - 5'-CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO mouse shRNA 2 DEPTOR was a gift from David Sabatini (Addgene plasmid # 21338 ; http://n2t.net/addgene:21338 ; RRID:Addgene_21338) -
For your References section:
DEPTOR is an mTOR inhibitor frequently overexpressed in multiple myeloma cells and required for their survival. Peterson TR, Laplante M, Thoreen CC, Sancak Y, Kang SA, Kuehl WM, Gray NS, Sabatini DM. Cell. 2009 May 29;137(5):873-86. doi: 10.1016/j.cell.2009.03.046. Epub 2009 May 14. 10.1016/j.cell.2009.03.046 PubMed 19446321