β2AR-PPI-CALPon1.0 (TEVp)
(Plasmid
#213407)
-
PurposePeroxidase (APEX) reporter for beta 2-adrenergic receptor (β2AR) and β-arrestin 2 interaction (component 2)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213407 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLX208
- Backbone size w/o insert (bp) 6769
-
Modifications to backboneno Hygromycin
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHA-arrestin-TEVp
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2019
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
β2AR-PPI-CALPon1.0 (TEVp) was a gift from Wenjing Wang (Addgene plasmid # 213407 ; http://n2t.net/addgene:213407 ; RRID:Addgene_213407) -
For your References section:
Modular Peroxidase-Based Reporters for Detecting Protease Activity and Protein Interactions with Temporal Gating. Zhou G, Wan WW, Wang W. J Am Chem Soc. 2022 Dec 21;144(50):22933-22940. doi: 10.1021/jacs.2c08280. Epub 2022 Dec 13. 10.1021/jacs.2c08280 PubMed 36511757