pLenti HsATP13A2 WT (PAM) _ Hygro
              
              
                (Plasmid
                
                #213697)
              
            
            
            
          - 
            Purposetransfer plasmid for lentiviral vector production expressing Hs ATP13A2 WT
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213697 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonelentiviral transferplasmid
- 
              Backbone manufacturerDidier Trono
- Backbone size w/o insert (bp) 11860
- Total vector size (bp) 15388
- 
              Vector typeLentiviral
- 
                Selectable markersHygromycin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert namehuman ATP13A2 WT PAM
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)3528
- 
                  MutationWT, D508N
- 
                    GenBank IDNP_001135445
- 
                        Entrez GeneATP13A2 (a.k.a. CLN12, HSA9947, KRPPD, PARK9, SPG78)
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAGACCTTGCATTCCTTTGG (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pLenti HsATP13A2 WT (PAM) _ Hygro was a gift from Veerle Baekelandt (Addgene plasmid # 213697 ; http://n2t.net/addgene:213697 ; RRID:Addgene_213697)
- 
                For your References section: Kufor-Rakeb syndrome-associated psychosis: a novel loss-of-function ATP13A2 variant and response to antipsychotic therapy. Colijn MA, Vrijsen S, Au PYB, Abou El Asrar R, Houdou M, Van den Haute C, Sarna J, Montgomery G, Vangheluwe P. Neurogenetics. 2024 Jul 18. doi: 10.1007/s10048-024-00767-7. 10.1007/s10048-024-00767-7 PubMed 39023817
