Skip to main content

pLenti HsATP13A2 P652_E653 del
(Plasmid #213700)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213700 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiviral transferplasmid
  • Backbone manufacturer
    Didier Trono
  • Backbone size w/o insert (bp) 11367
  • Total vector size (bp) 14913
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    human ATP13A2 P652_E653 del
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3528
  • Mutation
    WT, D962N
  • GenBank ID
    NP_001135445
  • Entrez Gene
    ATP13A2 (a.k.a. CLN12, HSA9947, KRPPD, PARK9, SPG78)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAGACCTTGCATTCCTTTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti HsATP13A2 P652_E653 del was a gift from Veerle Baekelandt (Addgene plasmid # 213700 ; http://n2t.net/addgene:213700 ; RRID:Addgene_213700)
  • For your References section:

    Kufor-Rakeb syndrome-associated psychosis: a novel loss-of-function ATP13A2 variant and response to antipsychotic therapy. Colijn MA, Vrijsen S, Au PYB, Abou El Asrar R, Houdou M, Van den Haute C, Sarna J, Montgomery G, Vangheluwe P. Neurogenetics. 2024 Jul 18. doi: 10.1007/s10048-024-00767-7. 10.1007/s10048-024-00767-7 PubMed 39023817