pLEW-pHluorin2-PTS1
(Plasmid
#213776)
-
PurposeExpresses the fluorescent protein pH sensor pHlorin2 in the glycosomes of Trypanosomal brucei
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213776 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLEW100v5
- Backbone size w/o insert (bp) 5560
- Total vector size (bp) 6292
-
Vector typeTrypanosoma brucei expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepHlorin2
-
SpeciesSynthetic
-
Insert Size (bp)732
-
MutationAppended a 2 glycine linker and a T. brucei peroxisome targeting sequence (AKL) at the C-terminus of pHlorin2
- Promoter T. brucei rRNA promotor
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CCCTATAGTGAGTCGTATTA
- 3′ sequencing primer GATTTAGGTGACACTATAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthesized from published AA sequence (https://doi.org/10.4236%2Fabb.2011.23021) at Twist Bioscience
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLEW-pHluorin2-PTS1 was a gift from Kenneth Christensen (Addgene plasmid # 213776 ; http://n2t.net/addgene:213776 ; RRID:Addgene_213776)