Skip to main content

p105_gRNA_Sa_CD40
(Plasmid #213781)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213781 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiviral
  • Vector type
    Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sa gRNA
  • gRNA/shRNA sequence
    GATGCGTCCCTAAACTCCCGG
  • Promoter mU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (unknown if destroyed)
  • 3′ cloning site Esp3I (unknown if destroyed)
  • 5′ sequencing primer NA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p105_gRNA_Sa_CD40 was a gift from Howard Chang (Addgene plasmid # 213781 ; http://n2t.net/addgene:213781 ; RRID:Addgene_213781)
  • For your References section:

    Bidirectional epigenetic editing reveals hierarchies in gene regulation. Pacalin NM, Steinhart Z, Shi Q, Belk JA, Dorovskyi D, Kraft K, Parker KR, Shy BR, Marson A, Chang HY. Nat Biotechnol. 2024 May 17. doi: 10.1038/s41587-024-02213-3. 10.1038/s41587-024-02213-3 PubMed 38760566