AAVS1-iPEmax-Hygro
(Plasmid
#214020)
-
Purposeinducible PEmax system for controllable prime editing; this plasmid is used to insert PEmax prime editor in one allele of AAVS1 locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214020 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAVS1 homologous recombination donor plasmid
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePEmax
-
SpeciesSynthetic; Cas9 is from S. pyogenes; M-MLV RT is from the Moloney murine leukemia virus
-
Insert Size (bp)6393
- Promoter TRE-tight
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer AATTCTGCAGATAAACGCTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-iPEmax-Hygro was a gift from Ting Zhou (Addgene plasmid # 214020 ; http://n2t.net/addgene:214020 ; RRID:Addgene_214020) -
For your References section:
Robust and inducible genome editing via an all-in-one prime editor in human pluripotent stem cells. Wu Y, Zhong A, Sidharta M, Kim TW, Ramirez B, Persily B, Studer L, Zhou T. Nat Commun. 2024 Dec 30;15(1):10824. doi: 10.1038/s41467-024-55104-1. 10.1038/s41467-024-55104-1 PubMed 39737975