lenti-EGFR-L858R-T790M-dual-epegRNA
(Plasmid
#214100)
-
PurposeLentiviral vector expressing epegRNAs for the induction of EGFR L858R and T790M mutations, through tandem U6 expression of the two epegRNAs using independent U6 promoters.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214100 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelenti-tmpknot-epegRNA-puro backbone
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFR L858R epegRNA/EGFR T790M epegRNA
-
gRNA/shRNA sequenceCAAGATCACAGATTTTGGGC; TAGTCCAGGAGGCAGCCGAA
-
SpeciesSynthetic
- Promoter hU6
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gtttcagacccacctcccaacc
- 3′ sequencing primer actgtgggcgatgtgcgctctgccc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti-EGFR-L858R-T790M-dual-epegRNA was a gift from Ting Zhou (Addgene plasmid # 214100 ; http://n2t.net/addgene:214100 ; RRID:Addgene_214100) -
For your References section:
Robust and inducible genome editing via an all-in-one prime editor in human pluripotent stem cells. Wu Y, Zhong A, Sidharta M, Kim TW, Ramirez B, Persily B, Studer L, Zhou T. Nat Commun. 2024 Dec 30;15(1):10824. doi: 10.1038/s41467-024-55104-1. 10.1038/s41467-024-55104-1 PubMed 39737975