piggyBAC-BRD4-Flag
(Plasmid
#214432)
-
PurposeA piggyBAC based plasmid for the stable expression of BRD4 with a flag tag.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214432 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLeicester38
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 11175
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBrd4 bromodomain containing 4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)4282
-
GenBank IDNM_020508.4 NM_001286630.1
-
Entrez GeneBrd4 (a.k.a. Brd5, HUNK1, MCAP, WI-11513)
- Promoter EF1
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ctgaccctgcttgctcaactc
- 3′ sequencing primer ccctaacgttactggccgaa
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
piggyBAC-BRD4-Flag was a gift from Shaun Cowley (Addgene plasmid # 214432 ; http://n2t.net/addgene:214432 ; RRID:Addgene_214432)