BirA*-HA-NES
(Plasmid
#214473)
-
PurposeLentiviral vector for expression in mammalian cells of the proximity ligase BirA(R118G) with a C-terminal HA tag followed by a nuclear exclusion sequence.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214473 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCSII-Rfa-IRES-Hygro Lentiviral Dest
-
Backbone manufacturerXuedong Liu, University of Colorado Boulder
- Backbone size w/o insert (bp) 12467
- Total vector size (bp) 12033
-
Vector typeMammalian Expression, Lentiviral ; Gateway
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBirA(R118G)
-
Alt nameBioID
-
SpeciesE. coli (bacteria)
-
MutationR118G
- Promoter EF-1a
-
Tags
/ Fusion Proteins
- HA tag (C terminal on insert)
- NES (Nuclear Exclusion Sequence) (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer ACTTTGTACAAGAAAGCTGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byFrom Addgene plasmid # 53581, from Karl Kramer.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This construct was used for BioID experiments (Roux et al., 2012, J Cell Biol 196, 801-810). BirA*-HA was inserted into an entry vector by PCR amplifying from Addgene plasmid # 53581 (a gift from Karl Kramer; http://n2t.net/addgene:53581 ; RRID:Addgene_53581). The NES sequence is from Wen et al. (1995, Cell 82, 463-473). Details on cloning and the sequences of entry vectors, cloning primers, and internal sequencing primers are provided in the supplemental material for Miller et al.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BirA*-HA-NES was a gift from Natalie Ahn (Addgene plasmid # 214473 ; http://n2t.net/addgene:214473 ; RRID:Addgene_214473) -
For your References section:
Cooperative polarization of MCAM/CD146 and ERM family proteins in melanoma. Miller SG, Hoh M, Ebmeier CC, Tay JW, Ahn NG. Mol Biol Cell. 2023 Dec 20:mbcE23060255. doi: 10.1091/mbc.E23-06-0255. 10.1091/mbc.E23-06-0255 PubMed 38117590