Skip to main content
Addgene

RDX-mCherry
(Plasmid #214476)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214476 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    mCherry-Ezrin-N-14
  • Backbone manufacturer
    Michael Davidson, Addgene Plasmid #55043
  • Total vector size (bp) 6439
  • Modifications to backbone
    Removed ezrin insert and replaced with RDX (radixin) insert.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RDX
  • Alt name
    radixin
  • Species
    H. sapiens (human)
  • Mutation
    Sequence matches cDNA clone MGC:48283 IMAGE:5284438 (GenBank Accession BC047109.1) which differs from the canonical sequence at one amino acid (K328E).
  • Entrez Gene
    RDX (a.k.a. DFNB24)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    CCSB-Boad Lentiviral Expression Library plasmid ccsbBroad304_06855 from the Functional Genomics facility at the University of Colorado Anschutz Medical Campus, Denver, CO.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid was generated by PCR amplifying RDX from the CCSB-Broad Lentiviral Expression Library collection (ccsbBroad304_06855, source clone GenBank accession: BC047109) and inserting it into the mCherry backbone which was PCR amplified from mCherry-Ezrin-N-14, a gift from Michael Davidson (Addgene plasmid # 55043 ; http://n2t.net/addgene:55043 ; RRID:Addgene_55043). RDX was inserted into the backbone using the FastCloning method (Li et al., 2011, BMC Biotechnol 11, 92). The primer sequences for FastCloning and internal sequencing primers are included in the supplemental material for Miller et al.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RDX-mCherry was a gift from Natalie Ahn (Addgene plasmid # 214476 ; http://n2t.net/addgene:214476 ; RRID:Addgene_214476)
  • For your References section:

    Cooperative polarization of MCAM/CD146 and ERM family proteins in melanoma. Miller SG, Hoh M, Ebmeier CC, Tay JW, Ahn NG. Mol Biol Cell. 2023 Dec 20:mbcE23060255. doi: 10.1091/mbc.E23-06-0255. 10.1091/mbc.E23-06-0255 PubMed 38117590