Skip to main content

pCI AscI MR1 R9H res
(Plasmid #214753)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214753 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCI
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4017
  • Total vector size (bp) 6363
  • Modifications to backbone
    inserted AscI restriction site upstream of CMV promoter - see Karamooz et al, 2019 (PMID: 30886396)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MHC class I-related protein 1
  • Alt name
    MR1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2381
  • Mutation
    silent mutations to prevent editing by CRISPR/Cas9 + sgRNA A from Laugel et al (PMID: 27307560) and Arg9 mutated to His (R9H) to prevent presentation of 5-OP-RU as described in Howson et al, 2020 (PMID: 32709702)
  • GenBank ID
    NM_001531.3
  • Entrez Gene
    MR1 (a.k.a. HLALS)
  • Promoter CMV
  • Tag / Fusion Protein
    • IRES eGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer CAGCTCTTAAGGCTAGAGTA
  • 3′ sequencing primer ctgagcaaagaccccaacgagaa
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Insert was designed based on NM_001531.3 and Howson et al, 2020 (PMID: 32709702) with the IRES found in Olive et al, 2014 (PMID: 24439903) and ordered from Thermo Fisher Gene Art

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI AscI MR1 R9H res was a gift from David Lewinsohn (Addgene plasmid # 214753 ; http://n2t.net/addgene:214753 ; RRID:Addgene_214753)
  • For your References section:

    Delivery of loaded MR1 monomer results in efficient ligand exchange to host MR1 and subsequent MR1T cell activation. Kulicke CA, Swarbrick GM, Ladd NA, Cansler M, Null M, Worley A, Lemon C, Ahmed T, Bennett J, Lust TN, Heisler CM, Huber ME, Krawic JR, Ankley LM, McBride SK, Tafesse FG, Olive AJ, Hildebrand WH, Lewinsohn DA, Adams EJ, Lewinsohn DM, Harriff MJ. Commun Biol. 2024 Feb 24;7(1):228. doi: 10.1038/s42003-024-05912-4. 10.1038/s42003-024-05912-4 PubMed 38402309