Skip to main content

pDisplay-PGD2-1.0-IRES-mcherry
(Plasmid #214762)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214762 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDisplay
  • Backbone size w/o insert (bp) 6534
  • Total vector size (bp) 8463
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GRAB-PGD2-1.0 sensor
  • Insert Size (bp)
    1929
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGGGCGGTAGGCGTGTA
  • 3′ sequencing primer CCTCACATTGCCAAAAGACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDisplay-PGD2-1.0-IRES-mcherry was a gift from Yulong Li (Addgene plasmid # 214762 ; http://n2t.net/addgene:214762 ; RRID:Addgene_214762)
  • For your References section:

    Prolonged sleep deprivation induces a cytokine-storm-like syndrome in mammals. Sang D, Lin K, Yang Y, Ran G, Li B, Chen C, Li Q, Ma Y, Lu L, Cui XY, Liu Z, Lv SQ, Luo M, Liu Q, Li Y, Zhang EE. Cell. 2023 Dec 7;186(25):5500-5516.e21. doi: 10.1016/j.cell.2023.10.025. Epub 2023 Nov 27. 10.1016/j.cell.2023.10.025 PubMed 38016470