pDisplay-PGD2-1.1-IRES-mcherry
(Plasmid
#214763)
-
PurposeExpress GRAB-PGD2-1.1 sensor and membrane tethered mCherry under CMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214763 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDisplay
- Backbone size w/o insert (bp) 6534
- Total vector size (bp) 8463
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGRAB-PGD2-1.1 sensor
-
SpeciesSynthetic
-
Insert Size (bp)1929
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGGCGGTAGGCGTGTA
- 3′ sequencing primer CCTCACATTGCCAAAAGACG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDisplay-PGD2-1.1-IRES-mcherry was a gift from Yulong Li (Addgene plasmid # 214763 ; http://n2t.net/addgene:214763 ; RRID:Addgene_214763) -
For your References section:
Prolonged sleep deprivation induces a cytokine-storm-like syndrome in mammals. Sang D, Lin K, Yang Y, Ran G, Li B, Chen C, Li Q, Ma Y, Lu L, Cui XY, Liu Z, Lv SQ, Luo M, Liu Q, Li Y, Zhang EE. Cell. 2023 Dec 7;186(25):5500-5516.e21. doi: 10.1016/j.cell.2023.10.025. Epub 2023 Nov 27. 10.1016/j.cell.2023.10.025 PubMed 38016470