Skip to main content

lentiviral shRNA GEF-H1
(Plasmid #21477)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21477 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    FUGW
  • Backbone manufacturer
    Available from Addgene (#14883)
  • Backbone size w/o insert (bp) 9941
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    30o in standard E.coli
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rho/rac guanine nucleotide exchange factor (GEF) 2
  • Alt name
    shRNA GEF-H1
  • Alt name
    Arhgef2
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    70
  • GenBank ID
    NM_001012079
  • Entrez Gene
    Arhgef2 (a.k.a. MGC95068)
  • Tag / Fusion Protein
    • eGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Pac I (not destroyed)
  • 3′ cloning site Pac I (not destroyed)
  • 5′ sequencing primer KT581 (ggattggggggtacagtgcaggggaaaga)
  • 3′ sequencing primer KT581 (atcaggaacgctcctgcgccctccgtctga)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiviral shRNA GEF-H1 was a gift from Richard Huganir (Addgene plasmid # 21477 ; http://n2t.net/addgene:21477 ; RRID:Addgene_21477)
  • For your References section:

    AMPA receptor and GEF-H1/Lfc complex regulates dendritic spine development through RhoA signaling cascade. Kang MG, Guo Y, Huganir RL. Proc Natl Acad Sci U S A. 2009 Mar 3. 106(9):3549-54. 10.1073/pnas.0812861106 PubMed 19208802