Skip to main content

Non tagged Avidin
(Plasmid #214835)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214835 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET21a
  • Total vector size (bp) 5768
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Non tagged Avidin
  • Species
    Streptomyces avidinii
  • Insert Size (bp)
    387
  • Promoter T7

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TAATAAAAGCTTGCGGCCGCACTCG
  • 3′ sequencing primer GGAAGCAGCGGACGGTTTAACTTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.01.21.576499 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Non tagged Avidin was a gift from Hironori Funabiki (Addgene plasmid # 214835 ; http://n2t.net/addgene:214835 ; RRID:Addgene_214835)
  • For your References section:

    MagIC-Cryo-EM, structural determination on magnetic beads for scarce macromolecules in heterogeneous samples. Arimura Y, Konishi HA, Funabiki H. eLife. 2025 May 20;13:RP103486. doi: 10.7554/eLife.103486. 10.7554/eLife.103486 PubMed 40390365