Non tagged Avidin
(Plasmid
#214835)
-
PurposeThis plasmid encodes a protein (Non tagged Avidin) that is used for generating functionalized magnetic beads for MagIC-cryo-EM, a method for single-particle cryo-EM analysis on magnetic beads.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214835 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET21a
- Total vector size (bp) 5768
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNon tagged Avidin
-
SpeciesStreptomyces avidinii
-
Insert Size (bp)387
- Promoter T7
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TAATAAAAGCTTGCGGCCGCACTCG
- 3′ sequencing primer GGAAGCAGCGGACGGTTTAACTTTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Non tagged Avidin was a gift from Hironori Funabiki (Addgene plasmid # 214835 ; http://n2t.net/addgene:214835 ; RRID:Addgene_214835) -
For your References section:
Cryo-EM analysis on magnetic beads for scarce macromolecules in heterogeneous samples. Arimura Y, Konishi HA, Funabiki H. bioRxiv. 2024. 10.1101/2024.01.21.576499