Skip to main content

pSLQ7534 pHR (hU6-crSURF1-EFS-PuroR-WPRE)
(Plasmid #214878)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214878 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hU6-crSURF1-EFS-PuroR-WPRE
  • gRNA/shRNA sequence
    aacccctaccaactggtcggggtttgaaacgagcagttcaaaatgacccagtccaagtaaacccctaccaactggtcggggtttgaaacagcaacagacgtaagaaccagagcaagtaaacccctaccaactggtcggggtttgaaacccatcatgtaggttgccgcacagcaagtaaacccctaccaactggtcggggtttgaaacgcagttgtgtgacacggaagcggcaagtaaacccctaccaactggtcggggtttgaaaccagaagaaaagtcagaggacacc
  • Species
    Synthetic
  • Promoter hU6

Cloning Information

  • Cloning method Gibson Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

RfxCas13d guide array targeting LAG3, FAS, CTLA4, PDCD1 (PD-1), HAVCR2 (TIM3)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ7534 pHR (hU6-crSURF1-EFS-PuroR-WPRE) was a gift from Stanley Qi (Addgene plasmid # 214878 ; http://n2t.net/addgene:214878 ; RRID:Addgene_214878)
  • For your References section:

    A versatile CRISPR-Cas13d platform for multiplexed transcriptomic regulation and metabolic engineering in primary human T cells. Tieu V, Sotillo E, Bjelajac JR, Chen C, Malipatlolla M, Guerrero JA, Xu P, Quinn PJ, Fisher C, Klysz D, Mackall CL, Qi LS. Cell. 2024 Feb 29;187(5):1278-1295.e20. doi: 10.1016/j.cell.2024.01.035. Epub 2024 Feb 21. 10.1016/j.cell.2024.01.035 PubMed 38387457