pSLQ7854 pHR (hU6-crGLY-EFS-PuroR-WPRE)
(Plasmid
#214884)
-
PurposeLentiviral vector encoding RfxCas13d targeting GLY guide array
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214884 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehU6-crGLY-EFS-PuroR-WPRE
-
gRNA/shRNA sequenceaacccctaccaactggtcggggtttgaaacaaatgagaacgtgaagcccagagcaagtaaacccctaccaactggtcggggtttgaaaccattccatgttcacacacatccgcaagtaaacccctaccaactggtcggggtttgaaactgtagccaatgaaggtgccatcacaagtaaacccctaccaactggtcggggtttgaaacagccgagacaatctctgcaccat
-
SpeciesSynthetic
- Promoter hU6
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
RfxCas13d guide array targeting HK1, HK2, AKT1, AKT2
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ7854 pHR (hU6-crGLY-EFS-PuroR-WPRE) was a gift from Stanley Qi (Addgene plasmid # 214884 ; http://n2t.net/addgene:214884 ; RRID:Addgene_214884) -
For your References section:
A versatile CRISPR-Cas13d platform for multiplexed transcriptomic regulation and metabolic engineering in primary human T cells. Tieu V, Sotillo E, Bjelajac JR, Chen C, Malipatlolla M, Guerrero JA, Xu P, Quinn PJ, Fisher C, Klysz D, Mackall CL, Qi LS. Cell. 2024 Feb 29;187(5):1278-1295.e20. doi: 10.1016/j.cell.2024.01.035. Epub 2024 Feb 21. 10.1016/j.cell.2024.01.035 PubMed 38387457