TRE-mClover3-TDP-43ΔNLS
(Plasmid
#214917)
-
Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear puncta
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214917 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelab generated
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTDP-43ΔNLS
-
SpeciesH. sapiens (human)
-
Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGTGGCAGTGGCAGCAGCA
-
Entrez GeneTARDBP (a.k.a. ALS10, TDP-43)
-
Tag
/ Fusion Protein
- mClover3 (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TRE-mClover3-TDP-43ΔNLS was a gift from Ophir Shalem (Addgene plasmid # 214917 ; http://n2t.net/addgene:214917 ; RRID:Addgene_214917) -
For your References section:
CRISPR screen for protein inclusion formation uncovers a role for SRRD in the regulation of intermediate filament dynamics and aggresome assembly. Sweeney KM, Chantarawong S, Barbieri EM, Cajka G, Liu M, Spruce L, Fazelinia H, Portz B, Copley K, Lapidot T, Duhamel L, Greenwald P, Saida N, Shalgi R, Shorter J, Shalem O. PLoS Genet. 2024 Feb 5;20(2):e1011138. doi: 10.1371/journal.pgen.1011138. eCollection 2024 Feb. 10.1371/journal.pgen.1011138 PubMed 38315730