Skip to main content

P-miR-145 (pTransluc-miR-145-1)
(Plasmid #21496)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21496 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTransluc (Panomics)
  • Backbone size w/o insert (bp) 4800
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    1.5kb 5' of miR-145
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1500
  • Entrez Gene
    MIR145 (a.k.a. MIRN145, miR-145, miRNA145)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site Bgl II (not destroyed)
  • 5′ sequencing primer ggtaccgagctcttacgcgt sequencing primer sequence
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid 21496: P-miR-145 (pTransluc-miR-145-1) has a mutation in the miR-145 sequence resulting in A to G mutation. The mutation is a SNP from the human ES cells H9.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P-miR-145 (pTransluc-miR-145-1) was a gift from Kenneth Kosik (Addgene plasmid # 21496 ; http://n2t.net/addgene:21496 ; RRID:Addgene_21496)
  • For your References section:

    MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. Xu N, Papagiannakopoulos T, Pan G, Thomson JA, Kosik KS. Cell. 2009 May 15. 137(4):647-58. 10.1016/j.cell.2009.02.038 PubMed 19409607