mNeonGreen-P2A-3xFLAG-msEEA1 HDR template
(Plasmid
#214990)
-
PurposeEndogenously tag mouse EEA1 with an N-terminal 3xFLAG in addition to cytosolic mNG for cell sorting.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214990 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC-GW-Amp
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEEA1
-
SpeciesM. musculus (mouse)
-
Entrez GeneEea1 (a.k.a. A430109M19Rik, B230358H09Rik, ZFYVE2)
-
Tag
/ Fusion Protein
- 3xFLAG (C terminal on insert)
Cloning Information
- Cloning method Unknown
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Target site is: CCGGCCAAACCATGTTTCGAAGG (AGG is the PAM). Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mNeonGreen-P2A-3xFLAG-msEEA1 HDR template was a gift from Wade Harper (Addgene plasmid # 214990 ; http://n2t.net/addgene:214990 ; RRID:Addgene_214990) -
For your References section:
Spatiotemporal proteomic profiling of cellular responses to NLRP3 agonists. Hollingsworth LR, Veeraraghavan P, Paulo JA, Harper JW. bioRxiv 2024.04.19.590338 10.1101/2024.04.19.590338