Skip to main content

pTwist Amp msTMEM115-TEV-3C-P2A-mScarlet-I HDR Template
(Plasmid #215000)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 215000 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTwist-Amp
  • Vector type
    HDR template
  • Selectable markers
    mScarlet-I

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    msTMEM115-TEV-3C-P2A-mScarlet-I HDR Template
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Tmem115 (a.k.a. Pl6, Pp6)
  • Promoter None
  • Tag / Fusion Protein
    • 3xHA (C terminal on insert)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Use the following genomic target sequence: GGGACGGTCACCTTCCCTGGGGG ( final "GGG" is the PAM site) . Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTwist Amp msTMEM115-TEV-3C-P2A-mScarlet-I HDR Template was a gift from Wade Harper (Addgene plasmid # 215000 ; http://n2t.net/addgene:215000 ; RRID:Addgene_215000)
  • For your References section:

    Spatiotemporal proteomic profiling of cellular responses to NLRP3 agonists. Hollingsworth LR, Veeraraghavan P, Paulo JA, Harper JW. bioRxiv 2024.04.19.590338 10.1101/2024.04.19.590338