pAAV_FKBP-V5-ALX1
(Plasmid
#215023)
-
PurposeAAV vector for knocking in an N-terminal tag (FKBP12F36V and V5) for human ALX1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 215023 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4098
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameALX homeobox 1
-
Alt nameALX1
-
Alt nameCART1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2105
-
Entrez GeneALX1 (a.k.a. CART1, FND3, HEL23)
-
Tag
/ Fusion Protein
- FKBP-V5 (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGTCCAACATTACCGCCATGTTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV_FKBP-V5-ALX1 was a gift from Joanna Wysocka (Addgene plasmid # 215023 ; http://n2t.net/addgene:215023 ; RRID:Addgene_215023) -
For your References section:
DNA-guided transcription factor cooperativity shapes face and limb mesenchyme. Kim S, Morgunova E, Naqvi S, Goovaerts S, Bader M, Koska M, Popov A, Luong C, Pogson A, Swigut T, Claes P, Taipale J, Wysocka J. Cell. 2024 Feb 1;187(3):692-711.e26. doi: 10.1016/j.cell.2023.12.032. Epub 2024 Jan 22. 10.1016/j.cell.2023.12.032 PubMed 38262408