pAAV-GFP
(Plasmid #32395)

• Depositing Lab: John T Gray
• Publication: Gray et al Methods Mol Biol. 2011;807:25-46.

Backbone

• Vector backbone: pSub201
• Backbone size w/o insert (bp): 8310
• Vector type: Mammalian Expression, AAV ; Adeno-Associated Virus

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl2
• Growth instructions: Users must confirm the absence of deletions (recombinations) in this vector by diagnostic digests. (1) A SmaI digest should produce the following pattern of bands: 3654 bp, 1716 bp and 1500 bp. (2) An AhdI digest should produce the following pattern of bands: 3183 bp, 2582 bp and 1127 bp. Please consult the associated publication listed below for an example gel image.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: GFP
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Multiple (see map) (not destroyed)
• 3′ cloning site: Multiple (see map) (not destroyed)
• 5′ sequencing primer: GGCCCTTTTGCTAATCATGTTCATACCTCTTATCT
• 3′ sequencing primer: GGCCAGGGCATTAGCCACACCAG

Resource Information

• Supplemental Documents:
  • LaserGene SeqBuilder file for pAAV-GFP
• Addgene Notes:
  • Addgene Diagnostic Digest for 32395 with SmaI
  • Addgene Diagnostic Digest for 32395 with AhdI
• A portion of this plasmid was derived from a plasmid made by: This plasmid was received by Dr. Gray’s lab from the Richard Mulligan lab of Harvard University.
• Articles Citing this Plasmid:
  • 11 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please see Notes from Addgene link above for Addgene's diagnostic digests of this plasmid with AhdI and SmaI.